shRNA Lentivirus (self-inactivating), pH1-(Cenpc1-shRNA-Seq4)(CAT#: LV-SI2592WQ)
This product is a Cenpc1-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The Cenpc1 gene is a centromere autoantigen and a component of the inner kinetochore plate. The encoded protein is required for maintaining proper kinetochore size and a timely transition to anaphase. The expression of Cenpc1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Retroviridae |
Species | Lentivirus |
Serotype | HIV-1 |
Backbone | Lenti-SIN |
Tropism | Both nondividing and dividing cells |
Insert | Cenpc1-shRNA-Seq4 |
Related Target/Protein | Cenpc1 |
Region | CDS |
TargetSeq | CCAAGAGTACAGAAGTCTTTA |
NCBI RefSeq | NM_007683 |
Alternative Names | MIF2; hcp-4; CENP-C; CENPC |
Titer | >1*10^10 GC/mL |