shRNA Lentivirus (self-inactivating), pH1-(Chst15-shRNA-Seq1)(CAT#: LV-SI2600WQ)

This product is a Chst15-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The Chst15 gene encodes a type II transmembrane glycoprotein that acts as a sulfotransferase to transfer sulfate to the C-6 hydroxal group of chondroitin sulfate. The expression of Chst15-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert Chst15-shRNA-Seq1
Related Target/Protein Chst15
Region CDS
TargetSeq CCTGGTCTTTGGATTGATAAT
NCBI RefSeq NM_029935
Alternative Names BRAG; GALNAC4S-6ST
Titer >1*10^10 GC/mL
Related Diseases Thrombus
Target Gene
Gene ID 51363
Uniprot ID Q7LFX5

Related Products