shRNA Lentivirus (self-inactivating), pH1-(CREG2-shRNA-Seq1)(CAT#: LV-SI0734WQ)

This product is a CREG2-shRNA encoding Lentivirus, which is based on HIV-1 serotype. Human and mouse CREG2 are putative secreted glycoproteins and may be novel neuronal extracellular molecules. The expression of CREG2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert CREG2-shRNA-Seq1
Related Target/Protein CREG2
Region CDS
TargetSeq CAGTATTTCAAGGGAGGAATA
NCBI RefSeq NM_153836
Titer >1*10^10 GC/mL
Related Diseases Brain disease
Target Gene
Gene ID 200407
Uniprot ID Q8IUH2

Related Products