shRNA Lentivirus (self-inactivating), pH1-(CREG2-shRNA-Seq1)(CAT#: LV-SI0734WQ)
This product is a CREG2-shRNA encoding Lentivirus, which is based on HIV-1 serotype. Human and mouse CREG2 are putative secreted glycoproteins and may be novel neuronal extracellular molecules. The expression of CREG2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Retroviridae |
Species | Lentivirus |
Serotype | HIV-1 |
Backbone | Lenti-SIN |
Tropism | Both nondividing and dividing cells |
Insert | CREG2-shRNA-Seq1 |
Related Target/Protein | CREG2 |
Region | CDS |
TargetSeq | CAGTATTTCAAGGGAGGAATA |
NCBI RefSeq | NM_153836 |
Titer | >1*10^10 GC/mL |
Related Diseases | Brain disease |