shRNA Lentivirus (self-inactivating), pH1-(Csrnp1-shRNA-Seq1)(CAT#: LV-SI2614WQ)
This product is a Csrnp1-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The Csrnp1 gene encodes a protein that localizes to the nucleus and expression of this gene is induced in response to elevated levels of axin. The expression of Csrnp1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Retroviridae |
Species | Lentivirus |
Serotype | HIV-1 |
Backbone | Lenti-SIN |
Tropism | Both nondividing and dividing cells |
Insert | Csrnp1-shRNA-Seq1 |
Related Target/Protein | Csrnp1 |
Region | CDS |
TargetSeq | CTGTGCCAGTGTAAGGATTAA |
NCBI RefSeq | NM_153287 |
Alternative Names | AXUD1; URAX1; TAIP-3; CSRNP-1; FAM130B |
Titer | >1*10^10 GC/mL |
Related Diseases | Cancer |