shRNA Lentivirus (self-inactivating), pH1-(Csrnp1-shRNA-Seq3)(CAT#: LV-SI2616WQ)

This product is a Csrnp1-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The Csrnp1 gene encodes a protein that localizes to the nucleus and expression of this gene is induced in response to elevated levels of axin. The expression of Csrnp1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert Csrnp1-shRNA-Seq3
Related Target/Protein Csrnp1
Region 3UTR
TargetSeq GTTTATGGCTGCTCTATTAAA
NCBI RefSeq NM_153287
Alternative Names AXUD1; URAX1; TAIP-3; CSRNP-1; FAM130B
Titer >1*10^10 GC/mL
Related Diseases Cancer
Target Gene
Gene ID 64651
Uniprot ID Q96S65

Related Products