shRNA Lentivirus (self-inactivating), pH1-(DDX3Y-shRNA-Seq2)(CAT#: LV-SI0518WQ)

This product is a DDX3Y-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The protein encoded by DDX3Y is a member of the DEAD-box RNA helicase family and is thought to be involved in ATP binding, hydrolysis, RNA binding, and in the formation of intramolecular interactions. Mutations in this gene result in male infertility, a reduction in germ cell numbers, and can result in Sertoli-cell only sydrome. The expression of DDX3Y-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert DDX3Y-shRNA-Seq2
Related Target/Protein DDX3Y
Region CDS
TargetSeq AGCGATATTGACATGGGAGAA
NCBI RefSeq NM_004660
Alternative Names DBY
Titer >1*10^10 GC/mL
Related Diseases Male infertility, Sertoli cell-only syndrome or severe hypospermatogenesis
Target Gene
Gene ID 8653
Uniprot ID O15523

Related Products