shRNA Lentivirus (self-inactivating), pH1-(Defb34-shRNA-Seq1)(CAT#: LV-SI3195WQ)
This product is a Defb34-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The protein encoded by Defb34 gene has antibacterial activity. The expression of Defb34-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | Defb34-shRNA-Seq1 |
| Related Target/Protein | Defb34 |
| Region | CDS |
| TargetSeq | GCAGCAGGATTAATGGGAGAT |
| NCBI RefSeq | NM_183035 |
| Alternative Names | BD-34 |
| Titer | >1*10^10 GC/mL |
