shRNA Lentivirus (self-inactivating), pH1-(DOLK-shRNA-Seq1)(CAT#: LV-SI0965WQ)

This product is a DOLK-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The protein encoded by DOLK gene catalyzes the CTP-mediated phosphorylation of dolichol, and is involved in the synthesis of Dol-P-Man. The expression of DOLK-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert DOLK-shRNA-Seq1
Related Target/Protein DOLK
Region CDS
TargetSeq GCAGATCATTTCTGTAGCTCT
NCBI RefSeq NM_014908
Alternative Names DK; DK1; CDG1M; SEC59; TMEM15
Titer >1*10^10 GC/mL
Related Diseases Dolichol kinase deficiency
Target Gene
Gene ID 22845
Uniprot ID Q9UPQ8

Related Products