shRNA Lentivirus (self-inactivating), pH1-(DPY19L4-shRNA-Seq4)(CAT#: LV-SI3041WQ)
This product is a DPY19L4-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The protein encoded by DPY19L4 gene is probable C-mannosyltransferase that mediates C-mannosylation of tryptophan residues on target proteins. The expression of DPY19L4-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Retroviridae |
Species | Lentivirus |
Serotype | HIV-1 |
Backbone | Lenti-SIN |
Tropism | Both nondividing and dividing cells |
Insert | DPY19L4-shRNA-Seq4 |
Related Target/Protein | DPY19L4 |
Region | CDS |
TargetSeq | GCGATTGACACAGTCTTCTTT |
NCBI RefSeq | NM_181787 |
Titer | >1*10^10 GC/mL |