shRNA Lentivirus (self-inactivating), pH1-(Fam107b-shRNA-Seq1)(CAT#: LV-SI3185WQ)

This product is a Fam107b-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The expression of Fam107b-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert Fam107b-shRNA-Seq1
Related Target/Protein Fam107b
Region CDS
TargetSeq GAAGACGAGACCAAGTGATAA
NCBI RefSeq NM_025626
Alternative Names HITS; C10orf45
Titer >1*10^10 GC/mL
Target Gene
Gene ID 83641
Uniprot ID Q9H098

Related Products