shRNA Lentivirus (self-inactivating), pH1-(FAM53C-shRNA-Seq2)(CAT#: LV-SI2372WQ)
This product is a FAM53C-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The protein encoded by FAM53C gene belongs to the FAM53 protein family. FAM53 protein family members bind to a transcriptional regulator that modulates cell proliferation. Alternative splicing results in multiple transcript variants. The expression of FAM53C-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | FAM53C-shRNA-Seq2 |
| Related Target/Protein | FAM53C |
| Region | CDS |
| TargetSeq | GACTTGAATTTGATTGAGGAA |
| NCBI RefSeq | NM_016605 |
| Alternative Names | C5orf6 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Prostate cancer |
