shRNA Lentivirus (self-inactivating), pH1-(Fchsd1-shRNA-Seq3)(CAT#: LV-SI2735WQ)
This product is a Fchsd1-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The protein encoded by Fchsd1 gene may promotes actin polymerization mediated by SNX9 and WASL. The expression of Fchsd1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Retroviridae |
Species | Lentivirus |
Serotype | HIV-1 |
Backbone | Lenti-SIN |
Tropism | Both nondividing and dividing cells |
Insert | Fchsd1-shRNA-Seq3 |
Related Target/Protein | Fchsd1 |
Region | CDS |
TargetSeq | GCTGAGCTTTCTGACTTCGAT |
NCBI RefSeq | NM_175684 |
Alternative Names | NWK2 |
Titer | >1*10^10 GC/mL |