shRNA Lentivirus (self-inactivating), pH1-(Gm16776-shRNA-Seq6)(CAT#: LV-SI2938WQ)
This product is a Gm16776-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The Gm16776 gene can regulate the immunoregulatory interactions between a Lymphoid and a non-Lymphoid cell. The expression of Gm16776-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | Gm16776-shRNA-Seq6 |
| Related Target/Protein | Gm16776 |
| Region | CDS |
| TargetSeq | GTGAGCCAATTTCAGGACATA |
| NCBI RefSeq | XM_355759 |
| Alternative Names | Trbv16; Tcrb-V11 |
| Titer | >1*10^10 GC/mL |
| Target Gene | |
|---|---|
| Gene ID | 100124680 |
| Uniprot ID | A0A0B4J1H3 |
