shRNA Lentivirus (self-inactivating), pH1-(LAMP3-shRNA-Seq1)(CAT#: LV-SI0740WQ)
This product is a LAMP3-shRNA encoding Lentivirus, which is based on HIV-1 serotype. LAMP3 regulates hepatic lipid metabolism through activating PI3K/Akt pathway. LAMP3 promotes the invasion of osteosarcoma cells via SPP1 signaling. LAMP3 expression correlated with poor clinical outcome in human ovarian cancer. The expression of LAMP3-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Retroviridae |
Species | Lentivirus |
Serotype | HIV-1 |
Backbone | Lenti-SIN |
Tropism | Both nondividing and dividing cells |
Insert | LAMP3-shRNA-Seq1 |
Related Target/Protein | LAMP3 |
Region | CDS |
TargetSeq | GTCAGTCAAGACTGGAATTTA |
NCBI RefSeq | NM_014398 |
Alternative Names | LAMP; CD208; DCLAMP; LAMP-3; TSC403; DC LAMP; DC-LAMP |
Titer | >1*10^10 GC/mL |
Related Diseases | Oral squamous cell carcinoma |