shRNA Lentivirus (self-inactivating), pH1-(LAMP3-shRNA-Seq1)(CAT#: LV-SI0740WQ)

This product is a LAMP3-shRNA encoding Lentivirus, which is based on HIV-1 serotype. LAMP3 regulates hepatic lipid metabolism through activating PI3K/Akt pathway. LAMP3 promotes the invasion of osteosarcoma cells via SPP1 signaling. LAMP3 expression correlated with poor clinical outcome in human ovarian cancer. The expression of LAMP3-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert LAMP3-shRNA-Seq1
Related Target/Protein LAMP3
Region CDS
TargetSeq GTCAGTCAAGACTGGAATTTA
NCBI RefSeq NM_014398
Alternative Names LAMP; CD208; DCLAMP; LAMP-3; TSC403; DC LAMP; DC-LAMP
Titer >1*10^10 GC/mL
Related Diseases Oral squamous cell carcinoma
Target Gene
Gene ID 27074
Uniprot ID Q9UQV4

Related Products