shRNA Lentivirus (self-inactivating), pH1-(LSM12-shRNA-Seq1)(CAT#: LV-SI0974WQ)
This product is a LSM12-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The expression of LSM12-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | LSM12-shRNA-Seq1 |
| Related Target/Protein | LSM12 |
| Region | 3UTR |
| TargetSeq | CCTTTACTTCTGACTTTCCTT |
| NCBI RefSeq | NM_152344 |
| Alternative Names | PNAS-135 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Oxidative Stress |
