shRNA Lentivirus (self-inactivating), pH1-(Lsm14a-shRNA-Seq4)(CAT#: LV-SI2631WQ)
This product is a Lsm14a-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The Lsm14a gene encodes Sm-like proteins that are thought to form a stable heteromer present in tri-snRNP particles, which are important for pre-mRNA splicing. The expression of Lsm14a-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | Lsm14a-shRNA-Seq4 |
| Related Target/Protein | Lsm14a |
| Region | 3UTR |
| TargetSeq | CCAGCTAAATGGAACTGCTAA |
| NCBI RefSeq | NM_025948 |
| Alternative Names | RAP55; FAM61A; RAP55A; C19orf13 |
| Titer | >1*10^10 GC/mL |
