shRNA Lentivirus (self-inactivating), pH1-(LSM14B-shRNA-Seq2)(CAT#: LV-SI0921WQ)
This product is a LSM14B-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The LSM14B gene may play a role in control of mRNA translation. The expression of LSM14B-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Retroviridae |
Species | Lentivirus |
Serotype | HIV-1 |
Backbone | Lenti-SIN |
Tropism | Both nondividing and dividing cells |
Insert | LSM14B-shRNA-Seq2 |
Related Target/Protein | LSM14B |
Region | CDS |
TargetSeq | GAGTGCAAATGCCCAGTTCAA |
NCBI RefSeq | NM_144703 |
Alternative Names | FT005; LSM13; FAM61B; RAP55B; C20orf40; bA11M20.3 Expression |
Titer | >1*10^10 GC/mL |
Related Diseases | Breast cancer |