shRNA Lentivirus (self-inactivating), pH1-(LY6G6D-shRNA-Seq1)(CAT#: LV-SI0668WQ)

This product is a LY6G6D-shRNA encoding Lentivirus, which is based on HIV-1 serotype. LY6G6D belongs to a cluster of leukocyte antigen-6 (LY6) genes and most LY6 proteins are attached to the cell surface by a glycosylphosphatidylinositol (GPI) anchor that is directly involved in signal transduction. The expression of LY6G6D-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert LY6G6D-shRNA-Seq1
Related Target/Protein LY6G6D
Region CDS
TargetSeq GACAACATGCAGGCCATCTAT
NCBI RefSeq NM_021246
Alternative Names G6D; NG25; LY6-D; MEGT1; C6orf23
Titer >1*10^10 GC/mL
Related Diseases Colorectal cancer
Target Gene
Gene ID 58530
Uniprot ID O95868

Related Products