shRNA Lentivirus (self-inactivating), pH1-(Lypd1-shRNA-Seq1)(CAT#: LV-SI3126WQ)

This product is a Lypd1-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The protein encoded by Lypd1 gene may play a role in the intracellular trafficking of alpha-4:beta-2 and alpha-7-containing nAChRs and may inhibit their expression at the cell surface. The expression of Lypd1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert Lypd1-shRNA-Seq1
Related Target/Protein Lypd1
Region CDS
TargetSeq CAGAAAGAAGTGATGGAGCAA
NCBI RefSeq NM_145100
Alternative Names PHTS; LYPDC1
Titer >1*10^10 GC/mL
Target Gene
Gene ID 116372
Uniprot ID Q8N2G4

Related Products