shRNA Lentivirus (self-inactivating), pH1-(Lypd1-shRNA-Seq1)(CAT#: LV-SI3126WQ)
This product is a Lypd1-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The protein encoded by Lypd1 gene may play a role in the intracellular trafficking of alpha-4:beta-2 and alpha-7-containing nAChRs and may inhibit their expression at the cell surface. The expression of Lypd1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Retroviridae |
Species | Lentivirus |
Serotype | HIV-1 |
Backbone | Lenti-SIN |
Tropism | Both nondividing and dividing cells |
Insert | Lypd1-shRNA-Seq1 |
Related Target/Protein | Lypd1 |
Region | CDS |
TargetSeq | CAGAAAGAAGTGATGGAGCAA |
NCBI RefSeq | NM_145100 |
Alternative Names | PHTS; LYPDC1 |
Titer | >1*10^10 GC/mL |