shRNA Lentivirus (self-inactivating), pH1-(MICALCL-shRNA-Seq3)(CAT#: LV-SI0587WQ)

This product is a MICALCL-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The MICALCL gene may cooperate with MAPK1/ERK2 via an intracellular signal transduction pathway in the morphogenetic development of round spermatids to spermatozoa and act as Rab effector protein and play a role in vesicle trafficking. The expression of MICALCL-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert MICALCL-shRNA-Seq3
Related Target/Protein MICALCL
Region CDS
TargetSeq CCCAGCTTTCCTTGCAGTTAA
NCBI RefSeq NM_032867
Alternative Names Ebitein1
Titer >1*10^10 GC/mL
Related Diseases Renal cancer
Target Gene
Gene ID 84953
Uniprot ID Q6ZW33

Related Products