shRNA Lentivirus (self-inactivating), pH1-(N4bp2-shRNA-Seq2)(CAT#: LV-SI2774WQ)
This product is a N4bp2-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The protein encoded by N4bp2 gene binds and hydrolyzes ATP, may function as a 5'-polynucleotide kinase, and has the capacity to be a ubiquitylation substrate. The expression of N4bp2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | N4bp2-shRNA-Seq2 |
| Related Target/Protein | N4bp2 |
| Region | CDS |
| TargetSeq | CTCCAGTAATCATAGATAATA |
| NCBI RefSeq | NM_001024917 |
| Alternative Names | B3BP |
| Titer | >1*10^10 GC/mL |
| Related Diseases | B-cell leukemia/lymphoma |
