shRNA Lentivirus (self-inactivating), pH1-(OR10G7-shRNA-Seq1)(CAT#: LV-SI2400WQ)

This product is a OR10G7-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The OR10G7 gene encodes a olfactory receptor protein that interacts with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The expression of OR10G7-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert OR10G7-shRNA-Seq1
Related Target/Protein OR10G7
Region CDS
TargetSeq GCCAACGAGATGGTCATCTTT
NCBI RefSeq XM_372437
Alternative Names OR11-283
Titer >1*10^10 GC/mL
Related Diseases Olfactory dysfunction
Target Gene
Gene ID 390265
Uniprot ID Q8NGN6

Related Products