shRNA Lentivirus (self-inactivating), pH1-(OR4S2-shRNA-Seq2)(CAT#: LV-SI2979WQ)
This product is a OR4S2-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The OR4S2 gene encodes a olfactory receptor protein that interacts with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The expression of OR4S2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | OR4S2-shRNA-Seq2 |
| Related Target/Protein | OR4S2 |
| Region | CDS |
| TargetSeq | CCTGCACTACACCATTATTAT |
| NCBI RefSeq | XM_166871 |
| Alternative Names | OR4S2P; OST725; OR11-137 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Olfactory dysfunction |
