shRNA Lentivirus (self-inactivating), pH1-(OR51F1-shRNA-Seq1)(CAT#: LV-SI3021WQ)

This product is a OR51F1-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The OR51F1 gene encodes a olfactory receptor protein that interacts with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The expression of OR51F1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert OR51F1-shRNA-Seq1
Related Target/Protein OR51F1
Region CDS
TargetSeq CCATGCATTGTCCTGTCATAT
NCBI RefSeq XM_171424
Alternative Names OR11-21; OR51F1P
Titer >1*10^10 GC/mL
Related Diseases Olfactory dysfunction
Target Gene
Gene ID 256892
Uniprot ID A6NGY5

Related Products