shRNA Lentivirus (self-inactivating), pH1-(PLEKHA6-shRNA-Seq1)(CAT#: LV-SI0888WQ)
This product is a PLEKHA6-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The PLEKHA6 gene is associated with psychopathology and response to treatment in schizophrenic patients.The expression of PLEKHA6-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | PLEKHA6-shRNA-Seq1 |
| Related Target/Protein | PLEKHA6 |
| Region | CDS |
| TargetSeq | CCAGCATTATGACGTGGACAT |
| NCBI RefSeq | NM_014935 |
| Alternative Names | PEPP3; PEPP-3 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Schizophrenic |
