shRNA Lentivirus (self-inactivating), pH1-(Psme4-shRNA-Seq4)(CAT#: LV-SI2574WQ)
This product is a Psme4-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The protein encoded by Psme4 gene is associated component of the proteasome that specifically recognizes acetylated histones and promotes ATP- and ubiquitin-independent degradation of core histones during spermatogenesis and DNA damage response. The expression of Psme4-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Retroviridae |
Species | Lentivirus |
Serotype | HIV-1 |
Backbone | Lenti-SIN |
Tropism | Both nondividing and dividing cells |
Insert | Psme4-shRNA-Seq4 |
Related Target/Protein | Psme4 |
Region | 3UTR |
TargetSeq | CTAGTACTATCATGGTATTAT |
NCBI RefSeq | NM_134013 |
Alternative Names | PA200 |
Titer | >1*10^10 GC/mL |
Related Diseases | Infertility |