shRNA Lentivirus (self-inactivating), pH1-(SAMD13-shRNA-Seq1)(CAT#: LV-SI0950WQ)

This product is a SAMD13-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The expression of SAMD13-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert SAMD13-shRNA-Seq1
Related Target/Protein SAMD13
Region CDS
TargetSeq CTCTGCAGACAAAGCATTTAA
NCBI RefSeq NM_001010971
Alternative Names HSD-41; HSD-42
Titer >1*10^10 GC/mL
Related Diseases Breast Cancer
Target Gene
Gene ID 148418
Uniprot ID Q5VXD3

Related Products