shRNA Lentivirus (self-inactivating), pH1-(SELRC1-shRNA-Seq1)(CAT#: LV-SI0806WQ)
This product is a SELRC1-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The SELRC1 gene is required for assembly of mitochondrial respiratory chain complex I and complex IV. The expression of SELRC1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Retroviridae |
Species | Lentivirus |
Serotype | HIV-1 |
Backbone | Lenti-SIN |
Tropism | Both nondividing and dividing cells |
Insert | SELRC1-shRNA-Seq1 |
Related Target/Protein | SELRC1 |
Region | CDS |
TargetSeq | GAAGTTTAACTGTGAAGAGAA |
NCBI RefSeq | NM_023077 |
Alternative Names | RESA1; SCAN3; COA7; C1orf163 |
Titer | >1*10^10 GC/mL |
Related Diseases | Respiratory disease |