shRNA Lentivirus (self-inactivating), pH1-(SPACA7-shRNA-Seq3)(CAT#: LV-SI0597WQ)

This product is a SPACA7-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The SPACA7 gene is involved in fertilization and seems not to play a direct role in sperm-egg binding or gamete fusion. The expression of SPACA7-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert SPACA7-shRNA-Seq3
Related Target/Protein SPACA7
Region CDS
TargetSeq GCGAAATGCCAAGTACAGCAT
NCBI RefSeq NM_145248
Alternative Names C13orf28
Titer >1*10^10 GC/mL
Related Diseases Infertility
Target Gene
Gene ID 122258
Uniprot ID Q96KW9

Related Products