shRNA Lentivirus (self-inactivating), pH1-(SPACA7-shRNA-Seq3)(CAT#: LV-SI0597WQ)
This product is a SPACA7-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The SPACA7 gene is involved in fertilization and seems not to play a direct role in sperm-egg binding or gamete fusion. The expression of SPACA7-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Retroviridae |
Species | Lentivirus |
Serotype | HIV-1 |
Backbone | Lenti-SIN |
Tropism | Both nondividing and dividing cells |
Insert | SPACA7-shRNA-Seq3 |
Related Target/Protein | SPACA7 |
Region | CDS |
TargetSeq | GCGAAATGCCAAGTACAGCAT |
NCBI RefSeq | NM_145248 |
Alternative Names | C13orf28 |
Titer | >1*10^10 GC/mL |
Related Diseases | Infertility |