shRNA Lentivirus (self-inactivating), pH1-(TDRD7-shRNA-Seq1)(CAT#: LV-SI0847WQ)

This product is a TDRD7-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The protein encoded by TDRD7 gene belongs to the Tudor family of proteins. This protein contains conserved Tudor domains and LOTUS domains. It is a component of RNA granules, which function in RNA processing. Mutations in this gene have been associated with cataract formation in mouse and human. The expression of TDRD7-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert TDRD7-shRNA-Seq1
Related Target/Protein TDRD7
Region 3UTR
TargetSeq CCTCTGAAACCTTGACAACTA
NCBI RefSeq NM_014290
Alternative Names TRAP; CATC4; PCTAIRE2BP
Titer >1*10^10 GC/mL
Related Diseases Congenital cataract and nonobstructive azoospermia
Target Gene
Gene ID 23424
Uniprot ID Q8NHU6

Related Products