shRNA Lentivirus (self-inactivating), pH1-(Vps13a-shRNA-Seq1)(CAT#: LV-SI3065WQ)

This product is a Vps13a-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The protein encoded by Vps13a gene may control steps in the cycling of proteins through the trans-Golgi network to endosomes, lysosomes and the plasma membrane. Mutations in this gene cause the autosomal recessive disorder, chorea-acanthocytosis. The expression of Vps13a-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert Vps13a-shRNA-Seq1
Related Target/Protein Vps13a
Region CDS
TargetSeq CCGTTTACAGATGTCAGTATT
NCBI RefSeq NM_173028
Alternative Names CHAC; CHOREIN
Titer >1*10^10 GC/mL
Related Diseases Autosomal recessive disorder, chorea-acanthocytosis
Target Gene
Gene ID 23230
Uniprot ID Q96RL7

Related Products