shRNA Lentivirus (self-inactivating), pH1-(WDR25-shRNA-Seq3)(CAT#: LV-SI0866WQ)
This product is a WDR25-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The WD domains of WDR25 gene are involved in protein-protein interactions in a variety of cellular processes, including cell cycle progression, signal transduction, apoptosis, and gene regulation. The expression of WDR25-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | WDR25-shRNA-Seq3 |
| Related Target/Protein | WDR25 |
| Region | CDS |
| TargetSeq | GAAGTGACTTTAGAATCACTA |
| NCBI RefSeq | NM_024515 |
| Alternative Names | C14orf67 |
| Titer | >1*10^10 GC/mL |
