shRNA Lentivirus (self-inactivating), pH1-(XKR6-shRNA-Seq4)(CAT#: LV-SI2849WQ)
This product is a XKR6-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The XKR6 gene may play an important role in cell apoptotic process. The expression of XKR6-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | XKR6-shRNA-Seq4 |
| Related Target/Protein | XKR6 |
| Region | CDS |
| TargetSeq | GATCGCAATGATGCTCTTATA |
| NCBI RefSeq | NM_173683 |
| Alternative Names | XRG6; C8orf5; C8orf7; C8orf21 |
| Titer | >1*10^10 GC/mL |
