shRNA Lentivirus (self-inactivating), pH1-(YPEL3-shRNA-Seq2)(CAT#: LV-SI0658WQ)
This product is a YPEL3-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The YPEL3 gene is involved in proliferation and apoptosis in myeloid precursor cells. The expression of YPEL3-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | YPEL3-shRNA-Seq2 |
| Related Target/Protein | YPEL3 |
| Region | CDS |
| TargetSeq | CAGGCCTACTTGGATGATTGT |
| NCBI RefSeq | NM_031477 |
| Alternative Names | Ypel3; Suap |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Mammary tumor |
