shRNA Lentivirus (self-inactivating), pH1-(ZDHHC19-shRNA-Seq1)(CAT#: LV-SI0579WQ)
This product is a ZDHHC19-shRNA encoding Lentivirus, which is based on HIV-1 serotype. ZDHHC19 is a Protein Coding gene. Gene Ontology (GO) annotations related to this gene include protein-cysteine S-palmitoyltransferase activity. The expression of ZDHHC19-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Retroviridae |
Species | Lentivirus |
Serotype | HIV-1 |
Backbone | Lenti-SIN |
Tropism | Both nondividing and dividing cells |
Insert | ZDHHC19-shRNA-Seq1 |
Related Target/Protein | ZDHHC19 |
Region | CDS |
TargetSeq | GCCAGCAACTGGTATTTAACA |
NCBI RefSeq | NM_144637 |
Alternative Names | DHHC19 |
Titer | >1*10^10 GC/mL |
Related Diseases | Liver cancer |