shRNA Lentivirus (self-inactivating), pU6-(2510006D16Rik-shRNA-Seq1)(CAT#: LV-SI2225WQ)

This product is a 2510006D16Rik-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The expression of 2510006D16Rik-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert 2510006D16Rik-shRNA-Seq1
Related Target/Protein 2510006D16Rik
Region CDS
TargetSeq GAAGATATTGGTGGGAAAGAA
NCBI RefSeq NM_029748
Alternative Names 1500002D11Rik; Tmem234; 4933407D05Rik
Titer >1*10^10 GC/mL
Target Gene
Gene ID 76799
Uniprot ID G3UZQ3

Related Products