shRNA Lentivirus (self-inactivating), pU6-(2610109H07Rik-shRNA-Seq1)(CAT#: LV-SI2292WQ)

This product is a 2610109H07Rik-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The expression of 2610109H07Rik-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert 2610109H07Rik-shRNA-Seq1
Related Target/Protein 2610109H07Rik
Region CDS
TargetSeq CACACTGGACATGGCCTTATT
NCBI RefSeq NM_027426
Alternative Names neucrin; Draxin
Titer >1*10^10 GC/mL
Target Gene
Gene ID 70433
Uniprot ID Q9D043

Related Products