shRNA Lentivirus (self-inactivating), pU6-(6030498E09Rik-shRNA-Seq3)(CAT#: LV-SI1909WQ)

This product is a 6030498E09Rik-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The expression of 6030498E09Rik-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert 6030498E09Rik-shRNA-Seq3
Related Target/Protein 6030498E09Rik
Region CDS
TargetSeq GATGATTCTGTGGGATCTATC
NCBI RefSeq NM_183126
Titer >1*10^10 GC/mL
Target Gene
Gene ID 77883
Uniprot ID B1AX85

Related Products