shRNA Lentivirus (self-inactivating), pU6-(A730089K16Rik-shRNA-Seq1)(CAT#: LV-SI2275WQ)
This product is a A730089K16Rik-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The expression of A730089K16Rik-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | A730089K16Rik-shRNA-Seq1 |
| Related Target/Protein | A730089K16Rik |
| Region | 3UTR |
| TargetSeq | CGGAAGCTAATAGGAAACTTT |
| NCBI RefSeq | NM_177156 |
| Titer | >1*10^10 GC/mL |
