shRNA Lentivirus (self-inactivating), pU6-(BC027231-shRNA-Seq2)(CAT#: LV-SI1984WQ)
This product is a BC027231-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The BC027231 gene may play a role in cortex development as part of the Notch signaling pathway. The expression of BC027231-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | BC027231-shRNA-Seq2 |
| Related Target/Protein | BC027231 |
| Region | CDS |
| TargetSeq | GAATCTCAAGGCTATAGTTTG |
| NCBI RefSeq | NM_145972 |
| Alternative Names | Nepro |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Neuronal differentiation and embryo development |
