shRNA Lentivirus (self-inactivating), pU6-(Bcdin3d-shRNA-Seq1)(CAT#: LV-SI2250WQ)

This product is a Bcdin3d-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The Bcdin3d gene encodes an RNA methyltransferase which belongs to the rossmann fold methyltransferase family, and serves as a 5'-methylphosphate capping enzyme that is specific for cytoplasmic histidyl tRNA. The expression of Bcdin3d-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert Bcdin3d-shRNA-Seq1
Related Target/Protein Bcdin3d
Region CDS
TargetSeq CTCTGTACAAACATTTCCTTT
NCBI RefSeq NM_029236
Titer >1*10^10 GC/mL
Related Diseases Breast cancer
Target Gene
Gene ID 144233
Uniprot ID Q7Z5W3

Related Products