shRNA Lentivirus (self-inactivating), pU6-(C10orf62-shRNA-Seq2)(CAT#: LV-SI0162WQ)

This product is a C10orf62-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The expression of C10orf62-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert C10orf62-shRNA-Seq2
Related Target/Protein C10orf62
Region CDS
TargetSeq GACAAGTCACCAGAATCCCAT
NCBI RefSeq NM_001009997
Alternative Names bA548K23.1
Titer >1*10^10 GC/mL
Related Diseases Testis cancer
Target Gene
Gene ID 414157
Uniprot ID Q5T681

Related Products