shRNA Lentivirus (self-inactivating), pU6-(C14orf70-shRNA-Seq2)(CAT#: LV-SI0489WQ)

This product is a C14orf70-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The expression of C14orf70-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert C14orf70-shRNA-Seq2
Related Target/Protein C14orf70
Region CDS
TargetSeq CGAGAAGAGGAGATGGAGAAT
NCBI RefSeq NM_001007560
Alternative Names LINC00523
Titer >1*10^10 GC/mL
Related Diseases Type 2 diabetes
Target Gene
Gene ID 283601
Uniprot ID Q86TU6

Related Products