shRNA Lentivirus (self-inactivating), pU6-(C20orf24-shRNA-Seq2)(CAT#: LV-SI0256WQ)

This product is a C20orf24-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The expression of C20orf24-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert C20orf24-shRNA-Seq2
Related Target/Protein C20orf24
Region CDS
TargetSeq GTACCTCTACTTCAGCAATTA
NCBI RefSeq NM_018840
Alternative Names RIP5; PNAS-11; RAB5IF
Titer >1*10^10 GC/mL
Target Gene
Gene ID 55969
Uniprot ID Q9BUV8

Related Products