shRNA Lentivirus (self-inactivating), pU6-(C22orf39-shRNA-Seq1)(CAT#: LV-SI0407WQ)
This product is a C22orf39-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The absence of the C22orf39 gene may be critical for inducing tumorigenesis. The expression of C22orf39-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Retroviridae |
Species | Lentivirus |
Serotype | HIV-1 |
Backbone | Lenti-SIN |
Tropism | Both nondividing and dividing cells |
Insert | C22orf39-shRNA-Seq1 |
Related Target/Protein | C22orf39 |
Region | 3UTR |
TargetSeq | GCGATGTTCTGCAGGACAATT |
NCBI RefSeq | NM_173793 |
Titer | >1*10^10 GC/mL |
Related Diseases | Liver cancer |