shRNA Lentivirus (self-inactivating), pU6-(CRAMP1L-shRNA-Seq1)(CAT#: LV-SI0380WQ)

Datasheet

This product is a CRAMP1L-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The expression of CRAMP1L-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert CRAMP1L-shRNA-Seq1
Related Target/Protein CRAMP1L
Region CDS
TargetSeq GATTACATTTCTCGGTTCAAT
NCBI RefSeq NM_020825
Alternative Names HN1L; TCE4; CRAMP1L
Titer >1*10^10 GC/mL
Related Diseases Lamotrigine (LTG)-induced maculopapular eruption (MPE)
Target Gene
Gene ID 57585
Uniprot ID Q96RY5

Related Products

shRNA Lentivirus (self-inactivating), p7SK-(OR5B12-shRNA-Seq1) (CAT#:LV-SI3349WQ) shRNA Lentivirus (self-inactivating), pU6-(4930447C04Rik-shRNA-Seq3) (CAT#:LV-SI1864WQ) Recombinant lentivirus, pU6-(Human GNAT1), Overexpression (CAT#:Lenti-GTOH0125WQ) Lenti-U6 (sgRNA)-SV40 (EGFP), NC (CAT#:Lenti-GTK0028WQ) shRNA Lentivirus (self-inactivating), p7SK-(C16orf62-shRNA-Seq1) (CAT#:LV-SI1487WQ) Recombinant lentivirus, pU6-(Human CXCL12), Overexpression (CAT#:Lenti-GTOH0779WQ) shRNA Lentivirus (self-inactivating), p7SK-(Eif2b1-shRNA-Seq4) (CAT#:LV-SI3614WQ) shRNA Lentivirus (self-inactivating), p7SK-(OR2T35-shRNA-Seq1) (CAT#:LV-SI3370WQ)