shRNA Lentivirus (self-inactivating), pU6-(Fbxw16-shRNA-Seq3)(CAT#: LV-SI1838WQ)
This product is a Fbxw16-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The expression of Fbxw16-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Retroviridae |
Species | Lentivirus |
Serotype | HIV-1 |
Backbone | Lenti-SIN |
Tropism | Both nondividing and dividing cells |
Insert | Fbxw16-shRNA-Seq3 |
Related Target/Protein | Fbxw16 |
Region | CDS |
TargetSeq | CCAGAACAGATCTTTAGACTA |
NCBI RefSeq | NM_177070 |
Alternative Names | 7420402K12Rik |
Titer | >1*10^10 GC/mL |