shRNA Lentivirus (self-inactivating), pU6-(Fbxw16-shRNA-Seq3)(CAT#: LV-SI1838WQ)

This product is a Fbxw16-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The expression of Fbxw16-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert Fbxw16-shRNA-Seq3
Related Target/Protein Fbxw16
Region CDS
TargetSeq CCAGAACAGATCTTTAGACTA
NCBI RefSeq NM_177070
Alternative Names 7420402K12Rik
Titer >1*10^10 GC/mL
Target Gene
Gene ID 320083
Uniprot ID Q497Z0

Related Products