shRNA Lentivirus (self-inactivating), pU6-(GOLGA8E-shRNA-Seq3)(CAT#: LV-SI0379WQ)

This product is a GOLGA8E-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The expression of GOLGA8E-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert GOLGA8E-shRNA-Seq3
Related Target/Protein GOLGA8E
Region 3UTR
TargetSeq GCCTATGTTCTGCTATTGTTT
NCBI RefSeq NM_001012423
Titer >1*10^10 GC/mL
Related Diseases Prader-Willi syndrome (PWS)
Target Gene
Gene ID 390535
Uniprot ID Q08AF8

Related Products