shRNA Lentivirus (self-inactivating), pU6-(Gvin1-shRNA-Seq4)(CAT#: LV-SI1756WQ)
This product is a Gvin1-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The protein encoded by Gvin1 gene belongs to the TRAFAC class dynamin-like GTPase superfamily. The expression of Gvin1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Retroviridae |
Species | Lentivirus |
Serotype | HIV-1 |
Backbone | Lenti-SIN |
Tropism | Both nondividing and dividing cells |
Insert | Gvin1-shRNA-Seq4 |
Related Target/Protein | Gvin1 |
Region | CDS |
TargetSeq | CCTGCTATCTCTGTCAGCATA |
NCBI RefSeq | NM_029000 |
Alternative Names | GVIN1; VLIG1; GVIN1P; VLIG-1; GVINP1 |
Titer | >1*10^10 GC/mL |