shRNA Lentivirus (self-inactivating), pU6-(Lactb2-shRNA-Seq7)(CAT#: LV-SI1939WQ)
This product is a Lactb2-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The Lactb2 gene is required for normal mitochondrial function and cell viability. The expression of Lactb2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | Lactb2-shRNA-Seq7 |
| Related Target/Protein | Lactb2 |
| Region | 3UTR |
| TargetSeq | GCTGGCTTACAGTTCAGAGAT |
| NCBI RefSeq | NM_145381 |
| Alternative Names | CGI-83 |
| Titer | >1*10^10 GC/mL |
